Search for a command to run...
Prunus necrotic ringspot virus (PNRSV, Ilarvirus PNRSV, genus Ilarvirus, family Bromoviridae) is an economically important virus with a wide host range, including stone fruit trees. The virus causes severe symptoms on leaves, shoots, flower buds, and fruits of infected plants, substantially reducing yield and damaging crop quality. Since no information is available on the occurrence of PNRSV in Azerbaijan, the aim of this research was to survey Azerbaijani stone fruit orchards for PNRSV. A total of 134 leaf samples were collected in 2018-2019 from 49 plum (Prunus domestica), 8 apricot (P. armeniaca), 13 almond (P. amygdalus), 22 peach (P. persica), 25 sweet cherry (P. avium), and 17 cherry plum (P. cerasifera) trees displaying typical leaf necrotic spots and shot hole symptoms (Oliver et al. 2009). Leaf samples were analyzed by DAS-ELISA using PNRSV-specific serological reagents (Neogen - Scotland, UK). In total PNRSV was detected in 8 plum, 1 apricot, 2 almond, 1 peach, 1 sweet cherry and 2 cherry plum samples. To confirm the presence of PNRSV, total RNA was isolated from symptomatic leaf samples (0.5 g) that tested positive in ELISA, as previously described (Foissac et al. 2005), and analyzed by RT-PCR using the OneStep RT-PCR kit (Qiagen) and primers designed to amplify a 302 bp fragment of the coat protein gene of PNRSV (F: 5′- CGAATTCCTAAGGGTTATGTAGCAC -3′ and R: 5’- GCAAAAGTGTCGAAATCTAAATCGG -3′). Primers were included for the NADH dehydrogenase subunit 5 that was used as an internal control (Menzel et al., 2002). RT-PCR included an initial denaturation for 5 min at 95 °C and 34 cycles of 10 s at 95 °C, 20 s at 50 °C, 20 s at 72 °C, followed by a final extension of 2 min at 72 °C. DNA amplicons were resolved by electrophoresis on 2% agarose gels and visualized under UV illumination after staining with GelRed (Biotium, Fremont, CA) (Mustafayev et al. 2025 a, b). PNRSV amplicons of the correct size were obtained from all samples, confirming the ELISA results. Next, a PCR product obtained from each host [plum (Baku 65 - PX091860), almond (Baku 147 - PX091861), apricot (Guba 195 - PX091862), cherry plum (Guba 197 - PX091863) and sweet cherry (Guba 250 - PX091864)] was purified with ExoSAP-IT (Thermo Fischer Scientific, Waltham, MA) and Sanger sequenced at the Cornell Biotechnology Resource Center (Ithaca, NY). Sequence analyses with the DNASTAR Lasergene software package (v17.3.0.57) showed high sequence identity among Azerbaijani PNRSV isolates at both the nucleotide (94.3%-98.6%) and amino acid (97.3%-99.1%) levels. A high nucleotide identity, ranging from 97.3% to 99.1%, was also recorded among PNRSV Azerbaijani isolates and isolates from Iran (MG788251, MG788254, MF767265), Israel (AY434714) and Italy (AF456215). To the best of our knowledge, this is the first confirmed report of PNRSV in plum, almond, sweet cherry, apricot, and cherry plum trees in Azerbaijan. These findings underscore the need for virus testing and stone fruit certification programs in the country.