TABLE. 4 in A revised infrageneric classification of Bellevalia Lapeyr. (Asparagaceae: Scilloideae) based on molecular analysis

20210 citationsDatasetgreen Open Access

Authors

Azarnoosh Jafari · Islamic Azad University, Mashhad

Jamil Vaezi · Ferdowsi University of Mashhad

Mohammad Mahdi Forghanifard · Islamic Azad University, Damghan Branch

Félix Forest · Royal Botanic Gardens, Kew

John C. Manning · South African National Biodiversity Institute

Abstract

TABLE. 4. Polymorphic positions of four chloroplast sequence alignment in the studied species of Bellevalia. Species/nucleotide positionmat Krbc Ltrn L introntrn L- trn F spacer1 6 71 7 63 0 64 5 45 3 29 3 01 0 3 21 2 6 61 3 3 51 8 7 01 9 0 01 9 8 72 0 1 12 1 2 52 4 4 02 4 6 02 5 1 82 7 1 33 1 1 03 1 2 53 1 5 7B. dubiaACTCGACCGCAGAACGAAAGAB. glaucaACTCGACCGCAGAACGAAAGAB. heweriACTCGACCGCAGAACGAAAGAB. longistylaACTCGACCGCAGAACGAAAGAB. savicziiACTCGACCGCAGAACGAAAGAB. speciosaACTCGACCGCAGAACGAAAGAB. macrobotrysACGTGATCGTAGAACGAAAGGB. romanaCCGTTATCGTAAAAACAAAAGB. tabrizianaCTGTTGTTATCAGGACGGCAGB. tristisCTGTTGTTATCAGGACGGCAGB. assadiiCTGTTGTTATCAGGACGGCAGB. fominiiCTGTTGTTATCAGGACGGCAGB. paradoxaCTGTTGTTATCAGGACGGCAGB. wendelboiCTGTTGTTATCAGGACGGCAG

Topics & Keywords

Publication Details

Published in: Zenodo (CERN European Organization for Nuclear Research)

DOI: 10.5281/zenodo.18382433

Command Palette

TABLE. 4 in A revised infrageneric classification of Bellevalia Lapeyr. (Asparagaceae: Scilloideae) based on molecular analysis

Authors

Abstract

Topics & Keywords

Publication Details